How to Genetically Modify a phage for Medical Purposes

By Alejandro Leyva

Bacteriophages are viruses that are used primarily to treat antibiotic-resistant bacterial infections. Environmentally, bacteriophages manage and balance bacteria populations by invading the prokaryotic bacteria and combusting them. Ranging around 24–200 nanometers, most phages specialize in destroying a single species of bacteria; phage treatment requires a variety of phage species to cure bacterial infections.

Typical Bacteriophage Structure By Nahla Mansour

There are two types of processes that phages use to destroy bacteria; The lytic process revolves around the phage replicating itself within the host bacteria and destroying it within an hour. The lysogenic process repeats the attachment and implant of the genes needed for the host bacteria to replicate the virus, except that the phages remain within the bacteria for multiple generations throughout bacterial replications. This prevents bacteria from surviving, and therefore, is used more often for treatment.

Phage Life Cycle by E.V Orlova

Typical phage therapy revolves around the injection of a group or “cocktail” of phages in the infected environment to target a specific group of bacteria that withstand antibiotics, or “superbugs”. The development of gene-editing technology CRISPR-CAS9 enhances the progress of research and further explores the versatility of bacteriophages and their applications in cancer treatment as well as other diseases. Specifically, scientists have learned to manipulate phage genomes so that phages target more than one type of bacteria, efficiently deliver a drug, or target cancer cells.

The Process

Phages bind to their host cells when their Receptor binding proteins on their tail fibers bind to a specific receptor on the surface of the host. These proteins are located on the tail of the phage, and while phages have relative similarity in the structure of the tail spike (phages can differ in structure, such as the M13 or MS2 phages), each receptor has a specialized sequence for its host. From there, the DNA of the phage is injected and adapted by the bacteria nucleus that reproduces the virus until it dies.

Let’s create a scenario where a scientist wants to find and edit the receptor of a certain phage to change its host bacteria.

Gather samples- Multiple phage samples that target certain bacteria are found where those bacteria are found. E. Coli targeting phages can be found in the sewers, the ocean, dirt, and so on. To verify the species, one can identify it based on the host bacteria, and filtering bacteria debris, after killing a bacterial colony using chloroform, within a sample to isolate the phages, known as phage isolation. The official name would be found by physical characteristics or sequencing the gene and comparing the similarity with several species using a computer program (indicated by percent of similarity); found in the International Committee on the taxonomy of viruses. To give an example of a sequenced phage genome.

Steps in Phage Isolation for therapeutic purposes by Małgorzata B. Lobocka

Sequencing- Before any genetic modification can be done, researchers must have sequenced the genome. The process would revolve around taking the entire genome and splitting it into separate parts and copying those segments for sequencing and analysis to ensure the reliability of the sequencing. To analyze these sequences, scientists must either rely on experiments that remove the unknown gene to understand what each nucleotide sequence performs, or rely on the already sequenced and analyzed genome. Verify that the species’ mutations have not affected any essential genes, because although rare, can still occur. Hierarchical shotgun sequencing is a hybrid of two techniques used during the human genome project and its competition with Celera.

By the Human Genome Project

If a new phage is found that kills a certain type of bacteria, that phage can be verified and named after the bacteria it kills. If that phage kills the same bacteria type as another phage containing a different structure verified by physical or genetic differences (after genetic sequencing), then that phage is labeled by number. To give an example, the phage that kills P. Aeruginosa is named PaP1. The abbreviation stands for Pseudomonas Aeruginosa Phage 1, and if there was another phage that killed the same bacteria with noticeable differences, the phage is named Pap2. After the species is verified, the phage gene must be analyzed

Genetic editing- Previously, scientists relied on horizontal gene transfer between a host bacteria and a lysogenic phage, an unreliable process. Scientists would insert a strain of desired DNA within the host bacteria of phage, in which the phage may or may not transfer after destroying the host bacteria within the petri dish. With CRISPR-Cas9, Scientists can edit multiple genetic sequences at once and reliably. To give an example, the phage that kills pseudomonas contains an excruciating list of nucleotides that determine the tail fiber and receptor Binding sites of P2 . 1

  1. GCCGGTGGTGTGGCTTACGACGGCGATGTAATTACGGTTTACCCCGGATAAGTGAATAATGAGCATAAATTCAGMCCGTTATCACCACTGCCGGG

501. TGGCGACGCAGGATTACGTTGATGACAAAATTGCAGGCAGTCACZACCCCGGACGCCTCGCTGACAGCAAAAGGTTTTACTCAGTTAAG HgIAI 3 9. 2 AatII 39.2

This sequence is just two columns, beginning, and end, of the genetic code for the tail fibers and the receptor-binding site. Imagine this but with 10 more columns, all in different locations of the genome.

Scientists also have to make sure that the DNA is not contaminated by some other process and also list the mutations as well as indicate transcription terminators with various symbols.

Now to the fun part, use other genetic sequences to replace the previous sequences to change the structure of the tail receptor protein. Inject CRISPR with the gene sequence in the phage. The Crispr will guide the CAS9 protein to the gene that needs to remove and replace, and implant the new piece of DNA manually. As the entire sequence of DNA has just been changed, the specific target will have changed and can be experimented on other species of phages.

By Alison Mackey

Ok, that’s cool, but how do you design a phage to kill a cancer cell?

Well, start by repeating steps 1–3. In step four, you need to program the phage vectors (almost complete genome) and incorporate the cis genetic (non-regulatory) elements of the adenovirus (the flu) to invade eukaryotic cells (human cells) using CRISPR. You have to program the phage to avoid an immune response and be able to target and destroy the cell needed. Gain a sample of the genome for the antigens of the surface of the cancer cell, and encode it within the phage genome for the receptor binding cells to target that cell and destroy it using drug therapy.

To attach a therapeutic drug, scientists use a process called phage display: the procedure of isolating binding peptides and applying them to phages. While there are three methods of phage display, a simple method is used called biopanning. The first step requires the gathering of phages and genetically altering (CRISPR) the phage to bind to the peptide, growing them, and then isolating and attaching the desired peptide to the phages. Then, the phages that do not bind to the peptide are washed away, and the antigen-specific phages are grown and analyzed for therapeutic uses. This process is also known as phage display because the phages display peptides on their surface.

An example of biopanning for developing therapeutic antibodies, By Yu-Chyi Hwang

The therapeutic drug is attached to the ligand (surface receptors) that will inhibit the cancer cells. Note that the phage can naturally penetrate through endothelial (main cancer cells, located on the outside layer of organs) barriers as well as survive in the bloodstream. Though for cancer treatment, the phage does not enter the cell.

For the phage to avoid the immune system and trigger a deadly immune response or completely flush the phage out of the system, one must attach the proteins to the ligand (surface) of the phage. This includes the natural antigens of the cells.

This treatment was used on the formerly incurable brain cancer glioblastoma, and scientists used enhanced drug therapy to target cancer. Phages are an efficient method to kill cancer by killing cancer cells that travel in the bloodstream, preventing metastatic cancer.

How about gene therapy?

Using genes being inserted into the perfected vector of an M13 filamentous (circular singular DNA structure) phage, scientists can input what gene that phage releases into the cells. This can trigger apoptosis in cancer cells, and handle genetic disorders. This technology as you can imagine, is highly influential in the progression of personalized medicine, the intense use of genetics to determine treatments. I would primarily use Lysogenic phages for the sake of efficiency, as lytic phages may destroy a cell quickly, but may not always prevent cell reproductions.

Vaccines?

Yup. Using phage display, Scientists can attach the harmless protein antigens of viruses to the phage ligand and inject the phage. The phage will trigger an immune response from immune cells. There are also Promoter driven vaccines that use DNA to deliver to target cells to elicit immune responses.

Tissue Engineering

Phages with peptides can be attached to scaffolds, using M13 phages. Used for tissue engineering, Scaffolds are materials that encourage development and cellular interactions. Scaffolds appear as networks of material in which phages can be attached to. Phages can mimic the niche of the cells in 3d scaffolds for development. M13 phages can mimic the extracellular matrix required as a base for cell development, and therefore encourage enzymatic activity required for the development. This is done by arranging these peptide displaying phages into a network with other catalysts to advance cellular development. It is important to note that M13 phages differ in structure from most phages.

By Andreas Kuhn

That's a long phage.

Imaging

Most image design techniques usually include attaching an imaging agent to the surface of the phage, where the phage transports that agent. The agent is usually encapsulated within an MS2 phage, where a laser is emitted on to the phage that reflects off of gold and produces fluorescence.

A couple of issues

While CRISPR-cas9 is generally reliable, phages can evolve in a way to prevent genetic binding. This is simply a common mutation.

Deadly immune response: if you want to use phages for medical purposes, it is important to note that some individuals have deadly reactions to phage treatment. The exact mechanism is unknown.

Funding and resources- it is still expensive to sequence a genome and uses CRISPR, so it must be incredibly well funded.

Conclusion

The point is that phages are no longer just replacements for antibiotics. Phages can be used for drug therapy, vaccines, cell and tissue targeting, disease diagnosis, gene therapy, and far more. Phages are the next step in advancing personalized medicine, with the convenience of highly precise phages to analyze disease and destroy disease quickly and efficiently; and safely.

Resources

https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0068562#pone.0068562.s002

https://www.frontiersin.org/articles/10.3389/fmicb.2019.00954/full

https://www.pnas.org/content/104/27/11197

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5408676/

https://www.pnas.org/content/117/4/1951

https://bmcbiotechnol.biomedcentral.com/articles/10.1186/1472-6750-8-37

https://jb.asm.org/content/jb/174/5/1462.full.pdf

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5311110/

https://www.researchgate.net/publication/338343963_Development_of_therapeutic_antibodies_for_the_treatment_of_diseases

https://www.sciencedirect.com/science/article/abs/pii/S0169409X1830317X

Get the Medium app

A button that says 'Download on the App Store', and if clicked it will lead you to the iOS App store
A button that says 'Get it on, Google Play', and if clicked it will lead you to the Google Play store